 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| CircDOCK1/hsa_circ_100721 | |||
| Gene | DOCK1 | Organism | Human |
| Genome Locus | n/a | Build | hg19 |
| Disease | Oral Squamous Cell Carcinoma | ICD-10 | Carcinoma in situ of oral cavity, oesophagus and stomach (D00) |
| DBLink | Link to database | PMID | 29286141 |
| Experimental Method | |||
| Sample Type | OSCC cells | Comparison | The human OSCC cell lines CAL-27, SCC-9 and SCC-25 and normal epithelial cells |
| Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
| Primers (Experimented) | Forward GAAATCGTCCACAGTGACCT ReverseCACAGTGTCTCCGATCTGTAAA | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
| Citation | |||
| Wang, L, Wei, Y, Yan, Y, Wang, H, Yang, J, Zheng, Z, Zha, J, Bo, P, Tang, Y, Guo, X, Chen, W, Zhu, X, Ge, L (2018). CircDOCK1 suppresses cell apoptosis via inhibition of miRí¢â‚¬"˜196aí¢â‚¬"˜5p by targeting BIRC3 in OSCC. Oncol. Rep., 39, 3:951-966. | |||